Review



pce mp53dd 41856  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Addgene inc pce mp53dd 41856
    Pce Mp53dd 41856, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 80 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pce+mp53dd/pCE-mp53DD+(Plasmid+%2341856)/pm41850000-45-16-19
    Average 95 stars, based on 80 article reviews
    pce mp53dd 41856 - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Electroporation:

    Article Title: Genome-scale CRISPR screens identify PTGES3 as a direct modulator of androgen receptor function in advanced prostate cancer.
    Article Snippet: C42B cells were treated with 50 ng ml−1 nocodazole (Sigma) for 14 h before electroporation. .. Cas9–sgRNA RNP complexes were assembled with 100 pmol Cas9 protein and 130 pmol sgRNA before electroporation and combined with 375 pmol homology-directed recombination template and 1 μg pCE-mp53DD (Addgene, cat. no. 41856) in a final volume of 25 μl. .. Electroporation was carried out following the protocol of SF Cell Line 4D-Nucleofector X Kit (Lonza, cat. no. V4XC-2024).

    Article Title: Genome-scale CRISPR screens identify PTGES3 as a direct modulator of androgen receptor function in advanced prostate cancer
    Article Snippet: C42B cells were treated with 50 ng ml −1 nocodazole (Sigma) for 14 h before electroporation. .. Cas9–sgRNA RNP complexes were assembled with 100 pmol Cas9 protein and 130 pmol sgRNA before electroporation and combined with 375 pmol homology-directed recombination template and 1 μg pCE-mp53DD (Addgene, cat. no. 41856) in a final volume of 25 μl. .. Electroporation was carried out following the protocol of SF Cell Line 4D-Nucleofector X Kit (Lonza, cat. no. V4XC-2024).

    Knock-In:

    Article Title: Phase-separated NDF-FACT condensates facilitate transcription elongation on chromatin.
    Article Snippet: .. To generate the knock-in cell lines, 0.7 μg PX459-Cas9-gRNA, 0.2 μg pCE-mP53DD (Addgene, 41586) and 1.2 μg donor vectors were transfected into 100,000 human iPS cells using 2 μl Lipofectamine Stem Transfection reagent (Thermo Fisher) following the manufacturer’s instructions. .. The non-homologous end-joining (NHEJ) inhibitor SCR7 (Sigma) was added at a final concentration of 1 μM to enhance homology-directed repair (HDR) efficiency.

    Article Title: Phase-separated NDF−FACT condensates facilitate transcription elongation on chromatin
    Article Snippet: .. To generate the knock-in cell lines, 0.7 μg PX459-Cas9-gRNA, 0.2 μg pCE-mP53DD (Addgene, 41586) and 1.2 μg donor vectors were transfected into 100,000 human iPS cells using 2 μl Lipofectamine Stem Transfection reagent (Thermo Fisher) following the manufacturer’s instructions. .. The non-homologous end-joining (NHEJ) inhibitor SCR7 (Sigma) was added at a final concentration of 1 μM to enhance homology-directed repair (HDR) efficiency.

    Transfection:

    Article Title: Phase-separated NDF-FACT condensates facilitate transcription elongation on chromatin.
    Article Snippet: .. To generate the knock-in cell lines, 0.7 μg PX459-Cas9-gRNA, 0.2 μg pCE-mP53DD (Addgene, 41586) and 1.2 μg donor vectors were transfected into 100,000 human iPS cells using 2 μl Lipofectamine Stem Transfection reagent (Thermo Fisher) following the manufacturer’s instructions. .. The non-homologous end-joining (NHEJ) inhibitor SCR7 (Sigma) was added at a final concentration of 1 μM to enhance homology-directed repair (HDR) efficiency.

    Article Title: Phase-separated NDF−FACT condensates facilitate transcription elongation on chromatin
    Article Snippet: .. To generate the knock-in cell lines, 0.7 μg PX459-Cas9-gRNA, 0.2 μg pCE-mP53DD (Addgene, 41586) and 1.2 μg donor vectors were transfected into 100,000 human iPS cells using 2 μl Lipofectamine Stem Transfection reagent (Thermo Fisher) following the manufacturer’s instructions. .. The non-homologous end-joining (NHEJ) inhibitor SCR7 (Sigma) was added at a final concentration of 1 μM to enhance homology-directed repair (HDR) efficiency.

    Plasmid Preparation:

    Article Title: Integrative multi-omic analysis links TDP-43-driven splicing defects to cascading proteomic disruption of ALS/FTD pathways
    Article Snippet: Briefly, BJFF.6 iPSCs (RRID:CVCL_VU02) were pretreated with mTeSR (Stem Cell Technologies) supplemented with 1X RevitaCell (Thermo Fisher Scientific) for 1 hour. .. Then, approximately 1X10 cells were transiently co-transfected with 1.15ug of SM32.hTDP43.g9 plasmid (cloned into Addgene #43860; spacer below), 1.5ug of p3s-Cas9HC plasmid (Addgene #43945), 2.8ug of SM32.eGFP donor (sequence below), and 500ng of pCE-mp53DD (Addgene #41856). .. The transfection was performed via nucleofection (Lonza, 4D-NucleofectorTM X-unit) using solution P3 and program CA-137 in a small (20ul) cuvette according to the manufacturer’s recommended protocol.

    Article Title: Forward programming of human pluripotent stem cells to generate glutamatergic and GABAergic neurons in a tri-culture model with astrocytes.
    Article Snippet: .. After that, 500 ng of the donor plasmid and 100 ng of the pCE-mp53DD (Addgene #41856) were added to tube A. .. In tube B, 1 μl of Lipofectamine STEM reagent (Thermo Fisher Scientific) was added to 25 μl of Opti-MEM.

    Article Title: Ultrasound Control of Gene Expression in Human iPSCs via Heat Shock Promoters
    Article Snippet: The AAVS1‐CAG‐LoxP‐DsRed‐STOP‐LoxP‐GFP donor plasmid was a gift from the Xiaoping Bao lab. IMR90 hiPSCs at about 70% confluency in a 6‐well plate were detached by treatment with Accutase and incubating the well at 37°C for 10 min. .. Cells were pelleted was resuspended in 100 μL PBS (Gibco, #14190136, Waltham, MA, USA) containing 7 μg donor plasmid, 7 μg of espCas9‐T2gRNA, and 2 μg pCE‐mp53DD (Addgene, #41856, Watertown, MA, USA). .. The T2 sgRNA (GGGGGCCACTAGGGACAGGAT) was ligated into the eSpCas9(1.1) plasmid (Addgene #71814, Watertown, MA, USA) that was digested with BbsI (New England Biolabs, #R0539S, Ipswich, MA, USA).

    Article Title: Forward programming of human pluripotent stem cells to generate glutamatergic and GABAergic neurons in a tri-culture model with astrocytes
    Article Snippet: .. After that, 500 ng of the donor plasmid and 100 ng of the pCE-mp53DD (Addgene #41856) were added to tube A. .. In tube B, 1 μl of Lipofectamine STEM reagent (Thermo Fisher Scientific) was added to 25 μl of Opti-MEM.

    Sequencing:

    Article Title: Integrative multi-omic analysis links TDP-43-driven splicing defects to cascading proteomic disruption of ALS/FTD pathways
    Article Snippet: Briefly, BJFF.6 iPSCs (RRID:CVCL_VU02) were pretreated with mTeSR (Stem Cell Technologies) supplemented with 1X RevitaCell (Thermo Fisher Scientific) for 1 hour. .. Then, approximately 1X10 cells were transiently co-transfected with 1.15ug of SM32.hTDP43.g9 plasmid (cloned into Addgene #43860; spacer below), 1.5ug of p3s-Cas9HC plasmid (Addgene #43945), 2.8ug of SM32.eGFP donor (sequence below), and 500ng of pCE-mp53DD (Addgene #41856). .. The transfection was performed via nucleofection (Lonza, 4D-NucleofectorTM X-unit) using solution P3 and program CA-137 in a small (20ul) cuvette according to the manufacturer’s recommended protocol.



    Similar Products

    95
    Addgene inc pce mp53dd 41856
    Pce Mp53dd 41856, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pce+mp53dd/pCE-mp53DD+(Plasmid+%2341856)/pm41850000-45-16-19
    Average 95 stars, based on 1 article reviews
    pce mp53dd 41856 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    Addgene inc pce mp53dd plasmid
    Pce Mp53dd Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pce+mp53dd/pCE-mp53DD+(Plasmid+%2341856)/pmc12989076-198-39-42
    Average 95 stars, based on 1 article reviews
    pce mp53dd plasmid - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    Addgene inc pce mp53dd
    Pce Mp53dd, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pce+mp53dd/pCE-mp53DD+(Plasmid+%2341856)/pm41742306-63-13-14
    Average 95 stars, based on 1 article reviews
    pce mp53dd - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    Addgene inc dominantnegative fragment
    Dominantnegative Fragment, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pce+mp53dd/pCE-mp53DD+(Plasmid+%2341856)/pm41660885-55-36-38
    Average 95 stars, based on 1 article reviews
    dominantnegative fragment - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    Addgene inc pce mp53 dd plasmid p53 dd
    ATRX LoF neuroblastoma cells have an impaired chromatin response to RA compared to their wild-type counterparts. (A) Time course experiment showing expression of CYP26A , normalized to GAPDH following exposure of <t>p53(2)</t> ( ATRX wildtype) and E6 ( ATRX LoF) cells to retinoic acid (RA). Data represented as mean ± SEM of n = 3 ( t test, * P <0.05). (B) HOXA1 and HOXA4 expression by RT-qPCR following 72 hours treatment with RA, compared to vehicle control. Inverse log delta CT is indicated. Where no expression was seen, this is indicated as 0. Mean ± SEM of n = 3; t test, * P < 0.05. (C) Clonogenic assay results for p53(2) and E6 cell lines following treatment with 10μM RA versus control (mean ± SEM of n = 3; t test, *** P < 0.001). (D-E) Volcano plots showing differentially accessible regions in E6 versus p53(2) cell lines following (D) vehicle control treatment conditions and (E) RA treatment. (F) Venn diagrams comparing differentially accessible transcription factor binding motifs following RA treatment in p53(2) and E6 cell lines. (G-J) Gene ontology analysis, comparing differential accessibility at gene promoters between E6 and p53(2) lines in (G) vehicle control conditions and (H) following treatment with RA. Displayed terms have been selected using REVIGO which eliminates redundant GO terms. (I-J) List of pathways grouped under the term “regionalization” and “embryonic skeletal system development” by Revigo for (I) vehicle control and (J) RA treated samples, respectively.
    Pce Mp53 Dd Plasmid P53 Dd, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pce+mp53dd/pCE-mp53DD+(Plasmid+%2341856)/pmc12753499-94-22-25
    Average 95 stars, based on 1 article reviews
    pce mp53 dd plasmid p53 dd - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    Addgene inc dominant negative fragment
    ATRX LoF neuroblastoma cells have an impaired chromatin response to RA compared to their wild-type counterparts. (A) Time course experiment showing expression of CYP26A , normalized to GAPDH following exposure of <t>p53(2)</t> ( ATRX wildtype) and E6 ( ATRX LoF) cells to retinoic acid (RA). Data represented as mean ± SEM of n = 3 ( t test, * P <0.05). (B) HOXA1 and HOXA4 expression by RT-qPCR following 72 hours treatment with RA, compared to vehicle control. Inverse log delta CT is indicated. Where no expression was seen, this is indicated as 0. Mean ± SEM of n = 3; t test, * P < 0.05. (C) Clonogenic assay results for p53(2) and E6 cell lines following treatment with 10μM RA versus control (mean ± SEM of n = 3; t test, *** P < 0.001). (D-E) Volcano plots showing differentially accessible regions in E6 versus p53(2) cell lines following (D) vehicle control treatment conditions and (E) RA treatment. (F) Venn diagrams comparing differentially accessible transcription factor binding motifs following RA treatment in p53(2) and E6 cell lines. (G-J) Gene ontology analysis, comparing differential accessibility at gene promoters between E6 and p53(2) lines in (G) vehicle control conditions and (H) following treatment with RA. Displayed terms have been selected using REVIGO which eliminates redundant GO terms. (I-J) List of pathways grouped under the term “regionalization” and “embryonic skeletal system development” by Revigo for (I) vehicle control and (J) RA treated samples, respectively.
    Dominant Negative Fragment, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pce+mp53dd/pCE-mp53DD+(Plasmid+%2341856)/bio_rxiv__64898__2025__12__29__696952-53-31-33
    Average 95 stars, based on 1 article reviews
    dominant negative fragment - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    Image Search Results


    ATRX LoF neuroblastoma cells have an impaired chromatin response to RA compared to their wild-type counterparts. (A) Time course experiment showing expression of CYP26A , normalized to GAPDH following exposure of p53(2) ( ATRX wildtype) and E6 ( ATRX LoF) cells to retinoic acid (RA). Data represented as mean ± SEM of n = 3 ( t test, * P <0.05). (B) HOXA1 and HOXA4 expression by RT-qPCR following 72 hours treatment with RA, compared to vehicle control. Inverse log delta CT is indicated. Where no expression was seen, this is indicated as 0. Mean ± SEM of n = 3; t test, * P < 0.05. (C) Clonogenic assay results for p53(2) and E6 cell lines following treatment with 10μM RA versus control (mean ± SEM of n = 3; t test, *** P < 0.001). (D-E) Volcano plots showing differentially accessible regions in E6 versus p53(2) cell lines following (D) vehicle control treatment conditions and (E) RA treatment. (F) Venn diagrams comparing differentially accessible transcription factor binding motifs following RA treatment in p53(2) and E6 cell lines. (G-J) Gene ontology analysis, comparing differential accessibility at gene promoters between E6 and p53(2) lines in (G) vehicle control conditions and (H) following treatment with RA. Displayed terms have been selected using REVIGO which eliminates redundant GO terms. (I-J) List of pathways grouped under the term “regionalization” and “embryonic skeletal system development” by Revigo for (I) vehicle control and (J) RA treated samples, respectively.

    Journal: Neoplasia (New York, N.Y.)

    Article Title: Differential chromatin accessibility response to retinoic acid in neuroblastoma with ATRX in-frame-deletions versus ATRX loss-of-function

    doi: 10.1016/j.neo.2025.101263

    Figure Lengend Snippet: ATRX LoF neuroblastoma cells have an impaired chromatin response to RA compared to their wild-type counterparts. (A) Time course experiment showing expression of CYP26A , normalized to GAPDH following exposure of p53(2) ( ATRX wildtype) and E6 ( ATRX LoF) cells to retinoic acid (RA). Data represented as mean ± SEM of n = 3 ( t test, * P <0.05). (B) HOXA1 and HOXA4 expression by RT-qPCR following 72 hours treatment with RA, compared to vehicle control. Inverse log delta CT is indicated. Where no expression was seen, this is indicated as 0. Mean ± SEM of n = 3; t test, * P < 0.05. (C) Clonogenic assay results for p53(2) and E6 cell lines following treatment with 10μM RA versus control (mean ± SEM of n = 3; t test, *** P < 0.001). (D-E) Volcano plots showing differentially accessible regions in E6 versus p53(2) cell lines following (D) vehicle control treatment conditions and (E) RA treatment. (F) Venn diagrams comparing differentially accessible transcription factor binding motifs following RA treatment in p53(2) and E6 cell lines. (G-J) Gene ontology analysis, comparing differential accessibility at gene promoters between E6 and p53(2) lines in (G) vehicle control conditions and (H) following treatment with RA. Displayed terms have been selected using REVIGO which eliminates redundant GO terms. (I-J) List of pathways grouped under the term “regionalization” and “embryonic skeletal system development” by Revigo for (I) vehicle control and (J) RA treated samples, respectively.

    Article Snippet: SH-SY5Y cells were subsequently electroporated with plasmids containing sgRNA for targeting Intron 1 and Intron 10 of ATRX as well as a pCE-mp53-DD plasmid (p53-DD) (Addgene Plasmid #41856) for transient inhibition of p53 [ , ] using the 4D-Nucleofector® X Unit with the SF Cell Line 4D-Nucleofector® X Kit L (Lonza, Cat# V4XC-2024), following the manufacturer’s protocol.

    Techniques: Expressing, Quantitative RT-PCR, Control, Clonogenic Assay, Binding Assay